Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification

Journal: Nature Communications

Article Title: LSD1 co-repressor Rcor2 orchestrates neurogenesis in the developing mouse brain

doi: 10.1038/ncomms10481

Figure Lengend Snippet: ( a ) X-gal staining to detect Rcor2 expression patterns. Whole-embryo staining at E11.5 stage shows Rcor2 is mainly expressed in the CNS. Scale bar, 1 mm. ( b ) Western blot analysis of Rcor2 expression levels during brain development. The decreased expression of Rcor2 with embryonic development is noteworthy. β-Actin is used as an endogenous control. ( c ) In situ hybridization to detect endogenous Rcor2 mRNA expression patterns in cortical development at E11.5, E13.5, E15.5 and E17.5. Insets show high-magnification image of Rcor2 expression in the neocortex at E13.5. VZ, ventricular zone; SVZ, subventricular zone; CP, cortical plate. Scale bar, 100 μm. ( d ) Confocal images of immunofluorescence to detect cellular localization of Rcor2 in the neocortex at E13.5. Rcor2 localized mainly in the nucleus at interphase and metaphase, and localized between separated chromosomes in anaphase of dividing cells in VZ. Dotted lines circle the shape of nuclei. Scale bar, 5 μm. ( e ) Western blot analysis of Rcor2 expression level in Rcor2 fl/fl and Rcor2 cko brains at E13.5 and E15.5, respectively. Rcor2 expression was depleted in Rcor2 cko brains. β-Actin is used as an endogenous control. ( f ) Representative images of Rcor2 fl/fl and Rcor2 cko brain size at different stages of development. Rcor2 cko mice show severe brain growth retardation at E13.5 and E15.5. Scale bar, 1 mm. ( g ) Representative images of Rcor2 fl/fl and Rcor2 cko cortex at E15.5 by Nissl staining. Structural abnormalities of lamination with reduced cortical thickness are observed in Rcor2 cko cortex. Scale bar, 200 μm. ( h ) RT–qPCR analysis of knockdown efficiencies of the two shRNAs targeting Rcor2. Transcripts were normalized to the control group. Data are shown as mean±s.e.m., t -test, **** P <0.0001, n =3. ( i ) Confocal images of E16.5 cortical sections electroporated with shControl (red), shRcor2-a (red) and shRcor2-b (red) plasmids at E13.5. Knockdown of Rcor2 results in impaired cortical development. IZ, intermediate zone. Scale bar, 20 μm. ( j ) Quantification of the percentage of RFP + cells in different regions of the developing neocortex after electroporation as shown in i . proportion of RFP + cells in different zones ( y axis). Data are shown as mean±s.e.m., t -test, * P <0.05, ** P <0.01, *** P <0.001 and **** P <0.0001, n =3 individual experiments.

Article Snippet: Primary antibodies used were as follows: Rcor2 (1:50, catalogue number NBP1-74099, Novus Biological); Nes (1:300, catalogue number Rat-401, DSHB); Pax6 (1:100, DSHB); Sox2 (1:500, catalogue number sc-17319, Santa Cruz); BrdU (1:500, catalogue number ab6326, Abcam); Ki67 (1:300, catalogue number ab9260, Millipore); Satb2 (1:500, catalogue number ab34735, Abcam); Olig2 (1:200, catalogue number ab109186, Abcam); Shh (1:100, catalogue number sc-33943, Santa Cruz); Ptch1 (1:100, catalogue number sc-6149, Santa Cruz); Dlx2 (1:500, catalogue number ab117546, Abcam); Nkx2.1 (1:300, catalogue number ab76013, Abcam); Tbr1 (1:500, catalogue number ab31940, Abcam); Dcx (1:500, catalogue number ab18723, Abcam); Tbr2 (1:500, catalogue number ab23345, Abcam); Flag M2 (1:1,000, catalogue number F1804, Sigma); Map2 (1:500, catalogue number ab32454, Abcam); and Tuj1 (1:1,000, catalogue number mms-435p, Convance).

Techniques: Staining, Expressing, Western Blot, Control, In Situ Hybridization, Immunofluorescence, Quantitative RT-PCR, Knockdown, Electroporation

Journal: Nature Communications

Article Title: LSD1 co-repressor Rcor2 orchestrates neurogenesis in the developing mouse brain

doi: 10.1038/ncomms10481

Figure Lengend Snippet: ( a ) Immunostaining images of Sox2 at E13.5. Sox2 is dramatically reduced on Rcor2 depletion. VZ, ventricular zone; SVZ, subventricular zone. Scale bar, 20 μm. ( b ) Quantification of Sox2 + cell ratios in VZ/SVZ regions shown in a . Data are shown as mean±s.e.m., t -test, ** P <0.01, n =3 individual experiments. ( c ) Confocal images of Tbr2 expression at E13.5. Tbr2 is dramatically reduced on Rcor2 depletion. Scale bar, 20 μm. ( d ) Quantification of Tbr2 + cell ratios in VZ/SVZ regions shown in c , respectively. Data are shown as mean±s.e.m., t -test, * P <0.05, n =3 individual experiments. ( e ) Immunostaining images of Nestin, Sox2 and Tbr2 in cultured Rcor2 fl/fl and Rcor2 cko NPCs, all of which exhibit significantly reduced expression in the Rcor2 cko NPCs. Scale bar, 20 μm. ( f ) Confocal images of immunofluorescence for Ki67 and PHH3 in Rcor2 fl/fl and Rcor2 cko cortex at E13.5 and E15.5. Ki67 signals (red), but not PHH3 signals (green), are dramatically reduced in Rcor2 cko developing brains. Scale bar, 20 μm. ( g ) Quantification of Ki67 + cells in the VZ/SVZ regions of the developing neocortex as shown in f . Data are shown as mean±s.e.m., t -test, ** P <0.01, n =3 separate stainings from three independent brains. ( h ) Confocal images of BrdU (green) and Ki67 (red) staining in Rcor2 fl/fl and Rcor2 cko cortex 24 and 48 h after BrdU incorporation. Scale bar, 100 μm. ( i ) Quantification of the cell cycle exit by percentage of BrdU + and Ki67 + NPCs divided by BrdU + cells shown in h . Data are shown as mean±s.e.m., t -test, *** P <0.001 and **** P <0.0001, n =3 individual experiments. ( j , k ) Representative images ( j ) and quantification of ( k ) of Rcor2 fl/fl and Rcor2 cko neurosphere sizes. The neurospheres'radius of Rcor2 cko are much smaller than those of Rcor2 fl/fl , t -test, **** P <0.0001, n =12. Scale bar, 50 μm. ( l ) Representative time-lapse imaging of the RGC dividing process in the sections of the cerebral cortex electroporated with RFP-shControl (upper panels) and RFP-shRcor2 (lower panels). The radial glial dividing pattern is abnormal on Rcor2 knockdown, resulting in cell death. Arrows, mother RGCs. Arrowheads, two daughter cells. Scale bar, 50 μm. ( m ) Representative time-lapse images of Rcor2 fl/fl cortex sections electroporated with EGFP-Control (upper panels) and EGFP-Cre (lower panels). Loss of cells is observed with Rcor2 knockout by Cre recombinase electroporation. Scale bar, 50 μm.

Article Snippet: Primary antibodies used were as follows: Rcor2 (1:50, catalogue number NBP1-74099, Novus Biological); Nes (1:300, catalogue number Rat-401, DSHB); Pax6 (1:100, DSHB); Sox2 (1:500, catalogue number sc-17319, Santa Cruz); BrdU (1:500, catalogue number ab6326, Abcam); Ki67 (1:300, catalogue number ab9260, Millipore); Satb2 (1:500, catalogue number ab34735, Abcam); Olig2 (1:200, catalogue number ab109186, Abcam); Shh (1:100, catalogue number sc-33943, Santa Cruz); Ptch1 (1:100, catalogue number sc-6149, Santa Cruz); Dlx2 (1:500, catalogue number ab117546, Abcam); Nkx2.1 (1:300, catalogue number ab76013, Abcam); Tbr1 (1:500, catalogue number ab31940, Abcam); Dcx (1:500, catalogue number ab18723, Abcam); Tbr2 (1:500, catalogue number ab23345, Abcam); Flag M2 (1:1,000, catalogue number F1804, Sigma); Map2 (1:500, catalogue number ab32454, Abcam); and Tuj1 (1:1,000, catalogue number mms-435p, Convance).

Techniques: Immunostaining, Expressing, Cell Culture, Immunofluorescence, Staining, BrdU Incorporation Assay, Imaging, Knockdown, Control, Knock-Out, Electroporation

Journal: Nature Communications

Article Title: LSD1 co-repressor Rcor2 orchestrates neurogenesis in the developing mouse brain

doi: 10.1038/ncomms10481

Figure Lengend Snippet: ( a ) Confocal images of Satb2 and Tbr1 expressions in Rcor2 fl/fl and Rcor2 cko cortex at E15.5, which exhibit significant reduction on Rcor2 knockout. Scale bar, 50 μm. ( b ) Quantification of Satb2 + and Tbr1 + cells in Rcor2 fl/fl and Rcor2 cko cortex at E15.5 in a indicates Satb2 and Tbr1 expressions are decreased on Rcor2 depletion during development. Data are shown as mean±s.e.m., t -test, ** P <0.01, n =3 individual experiments. ( c ) Western blot to analyse Dcx, Satb2 and Tbr1 expressions in Rcor2 fl/fl and Rcor2 cko cortex at E15.5. β-Actin is used as an endogenous control. ( d ) Representative images of Map2 and Tuj1 immunostaining in cultured neurons directly dissociated from Rcor2 fl/fl and Rcor2 cko brain cortex at E15.5. Decreased expression of both markers and reduced neurofilaments can be observed in Rcor2 cko cultured neurons. Scale bar, 20 μm. ( e ) Confocal images of in-vitro cultured Rcor2 fl/fl and Rcor2 cko NPCs 5 days post spontaneous differentiation using neuronal marker Map2 and Tuj1 antibodies, both of which are significantly reduced in the differentiated Rcor2 cko NPCs. Scale bar, 20 μm. ( f , g ) RT–qPCR analysis of neuronal markers expression in both Rcor2 fl/fl and Rcor2 cko neocortex at E15.5 stage ( f ) and in-vitro -cultured Rcor2 fl/fl and Rcor2 cko NPCs 5 days post spontaneous differentiation ( g ). Transcripts were normalized to Rcor2 fl/fl group. Data are shown as mean±s.d., t -test, * P <0.05, ** P <0.01 and *** P <0.001, n =3.

Article Snippet: Primary antibodies used were as follows: Rcor2 (1:50, catalogue number NBP1-74099, Novus Biological); Nes (1:300, catalogue number Rat-401, DSHB); Pax6 (1:100, DSHB); Sox2 (1:500, catalogue number sc-17319, Santa Cruz); BrdU (1:500, catalogue number ab6326, Abcam); Ki67 (1:300, catalogue number ab9260, Millipore); Satb2 (1:500, catalogue number ab34735, Abcam); Olig2 (1:200, catalogue number ab109186, Abcam); Shh (1:100, catalogue number sc-33943, Santa Cruz); Ptch1 (1:100, catalogue number sc-6149, Santa Cruz); Dlx2 (1:500, catalogue number ab117546, Abcam); Nkx2.1 (1:300, catalogue number ab76013, Abcam); Tbr1 (1:500, catalogue number ab31940, Abcam); Dcx (1:500, catalogue number ab18723, Abcam); Tbr2 (1:500, catalogue number ab23345, Abcam); Flag M2 (1:1,000, catalogue number F1804, Sigma); Map2 (1:500, catalogue number ab32454, Abcam); and Tuj1 (1:1,000, catalogue number mms-435p, Convance).

Techniques: Knock-Out, Western Blot, Control, Immunostaining, Cell Culture, Expressing, In Vitro, Marker, Quantitative RT-PCR

Journal: Nature Communications

Article Title: LSD1 co-repressor Rcor2 orchestrates neurogenesis in the developing mouse brain

doi: 10.1038/ncomms10481

Figure Lengend Snippet: ( a ) Schematic overview of strategy to generate an Rcor2 Flag knock-in allele by CRISPR/Cas9. The sgRNA sequence site is shown as a green arrowhead. The start codon of Rcor2 is indicated and capitalized. The oligo donor contained 50 bp homologies on both sides flanking the DSB, in which 3 × Flag sequences are labelled as a red box. ( b ) Western blot analysis to validate FLAG, RCOR2 and LSD1 expressions in Rcor2 Flag knock-in neocortex using Flag-M2 antibody. β-Actin was used as an endogenous control. ( c ) Pie chart depicts distribution of Rcor2 occupancies in genome-wide scale in FLAG ChIP-seq results using Rcor2 Flag knock-in neocortex at E13.5. ( d ) WebLogos of consensus binding motifs of Rcor2 generated by Multiple EM for Motif Elicitation (MEME) motif analysis tool. ( e ) GO analysis for Rcor2-binding regions in genome-wide scale revealed by Flag ChIP-seq results using Rcor2 Flag brain. ( f ) GO analysis for LSD1 occupancy in genome-wide scale revealed by LSD1 ChIP-seq results using Rcor2 Flag brain. ( g ) Density plots analysis of H3K4me1 signal change in promoter regions (−2- to ∼0.5 kb from TSS) on Rcor2 depletion. Compared with all genes, the change of H3K4me1 signal is significantly ( P <0.0005, Kolmogorov–Smirnov test) enhanced in the promoter regions of Shh pathway-related genes on Rcor2 depletion. H3K4me1 signal change on Rcor2 depletion ( x axis); H3K4me1 signal density ( y axis). ( h ) Gene tracks of Rcor2, LSD1 and H3K4me1 enrichments by ChIP-seq analysis at core promoter regions of Dlx2 and upstream regulatory regions of Shh, which are closely related to Shh signalling. ( i ) ChIP–qPCR analysis of Rcor2 Flag and Rcor2 cko cortex at E13.5 using specific FLAG-M2 antibody. Significant enrichments of the Rcor2 at the regulatory regions of Dlx2 and Shh gene locus detected in g in the Rcor2 flag samples are worth noting. Fold enrichments of Rcor2 occupancy compared with input ( y axis). Data are shown as mean±s.d., t -test, *** P <0.001, n =3.

Article Snippet: Primary antibodies used were as follows: Rcor2 (1:50, catalogue number NBP1-74099, Novus Biological); Nes (1:300, catalogue number Rat-401, DSHB); Pax6 (1:100, DSHB); Sox2 (1:500, catalogue number sc-17319, Santa Cruz); BrdU (1:500, catalogue number ab6326, Abcam); Ki67 (1:300, catalogue number ab9260, Millipore); Satb2 (1:500, catalogue number ab34735, Abcam); Olig2 (1:200, catalogue number ab109186, Abcam); Shh (1:100, catalogue number sc-33943, Santa Cruz); Ptch1 (1:100, catalogue number sc-6149, Santa Cruz); Dlx2 (1:500, catalogue number ab117546, Abcam); Nkx2.1 (1:300, catalogue number ab76013, Abcam); Tbr1 (1:500, catalogue number ab31940, Abcam); Dcx (1:500, catalogue number ab18723, Abcam); Tbr2 (1:500, catalogue number ab23345, Abcam); Flag M2 (1:1,000, catalogue number F1804, Sigma); Map2 (1:500, catalogue number ab32454, Abcam); and Tuj1 (1:1,000, catalogue number mms-435p, Convance).

Techniques: Knock-In, CRISPR, Sequencing, Western Blot, Control, Genome Wide, ChIP-sequencing, Binding Assay, Generated, ChIP-qPCR

Journal: Nature Communications

Article Title: LSD1 co-repressor Rcor2 orchestrates neurogenesis in the developing mouse brain

doi: 10.1038/ncomms10481

Figure Lengend Snippet: ( a , b ) Scatter plot analysis of genome-wide expression profiles of Rcor2 cko versus Rcor2 fl/fl samples at E13.5 ( a ) and E15.5 ( b ). Dots above or below the dash line indicate upregulated or downregulated genes on Rcor2 depletion, respectively. Red dots or green dots highlight the significantly differentially expressed genes on Rcor2 depletion. Raw counts ( x axis); gene expression fold changes on Rcor2 depletion ( y axis). ( c ) Venn diagrams of upregulated genes (left) and downregulated genes (right) in Rcor2 cko samples compared with Rcor2 fl/fl samples. ( d ) The profiles of Rcor2 and H3k4me1 enrichments analysed in ChIP-seq results shown in in regulatory regions of genome-wide scale (red) and of the upregulated genes (purple) according to RNA-seq results. ( e ) Correlation network of overlapped upregulated genes in both E13.5 and E15.5 samples. Lines indicate the correlations between two connected genes with R >0.55. Genes were analysed by GO analysis and divided into different categories.

Article Snippet: Primary antibodies used were as follows: Rcor2 (1:50, catalogue number NBP1-74099, Novus Biological); Nes (1:300, catalogue number Rat-401, DSHB); Pax6 (1:100, DSHB); Sox2 (1:500, catalogue number sc-17319, Santa Cruz); BrdU (1:500, catalogue number ab6326, Abcam); Ki67 (1:300, catalogue number ab9260, Millipore); Satb2 (1:500, catalogue number ab34735, Abcam); Olig2 (1:200, catalogue number ab109186, Abcam); Shh (1:100, catalogue number sc-33943, Santa Cruz); Ptch1 (1:100, catalogue number sc-6149, Santa Cruz); Dlx2 (1:500, catalogue number ab117546, Abcam); Nkx2.1 (1:300, catalogue number ab76013, Abcam); Tbr1 (1:500, catalogue number ab31940, Abcam); Dcx (1:500, catalogue number ab18723, Abcam); Tbr2 (1:500, catalogue number ab23345, Abcam); Flag M2 (1:1,000, catalogue number F1804, Sigma); Map2 (1:500, catalogue number ab32454, Abcam); and Tuj1 (1:1,000, catalogue number mms-435p, Convance).

Techniques: Genome Wide, Expressing, Gene Expression, ChIP-sequencing, RNA Sequencing

Journal: Nature Communications

Article Title: LSD1 co-repressor Rcor2 orchestrates neurogenesis in the developing mouse brain

doi: 10.1038/ncomms10481

Figure Lengend Snippet: ( a ) qPCR analysis of the expression of genes related to the Shh signalling pathway in the cortex of Rcor2 fl/fl and Rcor2 cko brains during development. Significant upregulation of these genes on Rcor2 depletion is noteworthy. Transcripts were normalized to Rcor2 fl/fl group. Data are shown as mean±s.d., t -test, * P <0.05, ** P <0.01 and *** P <0.001, n =3. ( b ) Confocal images of Shh and Ptch1 expressions in Rcor2 fl/fl and Rcor2 cko cortex. Enhanced Shh and Ptch1 signals are observed in Rcor2 cko compared with Rcor2 fl/fl neocortex at E13.5 and E15.5. Insets show high-magnification images of the outlined regions. Scale bars, 50 μm. ( c ) Dlx2 expression in Rcor2 fl/fl and Rcor2 cko cortex detected by immunofluorescence analysis at E15.5. Dlx2 + cells were observed in the neocortex on Rcor2 depletion. Scale bars, 50 μm. ( d ) Confocal images of Shh, Ptch1 and Dlx2 expressions in in-vitro -cultured Rcor2 cko NPCs. Scale bar, 20 μm. ( e ) Western blot analysis of expression levels of Dlx2, Shh and Ptch1 in Rcor2 fl/fl and Rcor2 cko cortex at E15.5. β-Actin is used as an endogenous control.

Article Snippet: Primary antibodies used were as follows: Rcor2 (1:50, catalogue number NBP1-74099, Novus Biological); Nes (1:300, catalogue number Rat-401, DSHB); Pax6 (1:100, DSHB); Sox2 (1:500, catalogue number sc-17319, Santa Cruz); BrdU (1:500, catalogue number ab6326, Abcam); Ki67 (1:300, catalogue number ab9260, Millipore); Satb2 (1:500, catalogue number ab34735, Abcam); Olig2 (1:200, catalogue number ab109186, Abcam); Shh (1:100, catalogue number sc-33943, Santa Cruz); Ptch1 (1:100, catalogue number sc-6149, Santa Cruz); Dlx2 (1:500, catalogue number ab117546, Abcam); Nkx2.1 (1:300, catalogue number ab76013, Abcam); Tbr1 (1:500, catalogue number ab31940, Abcam); Dcx (1:500, catalogue number ab18723, Abcam); Tbr2 (1:500, catalogue number ab23345, Abcam); Flag M2 (1:1,000, catalogue number F1804, Sigma); Map2 (1:500, catalogue number ab32454, Abcam); and Tuj1 (1:1,000, catalogue number mms-435p, Convance).

Techniques: Expressing, Immunofluorescence, In Vitro, Cell Culture, Western Blot, Control

Journal: Nature Communications

Article Title: LSD1 co-repressor Rcor2 orchestrates neurogenesis in the developing mouse brain

doi: 10.1038/ncomms10481

Figure Lengend Snippet: ( a ) Knockdown of Rcor2 impairs cortical neurogenesis, which can be partially rescued by knockdown of Shh during cortical development. In-utero electroporation with RFP-shControl (red)/GFP-shControl (green), RFP-shRcor2 (red)/GFP-shControl (green), RFP-shControl (red)/GFP-shShh (green) or RFP-shRcor2 (red)/GFP-shShh (green) plasmids was performed at E13.5. Cerebral sections were fixed and imaged at E16.5. VZ, ventricular zone; SVZ, subventricular zone; CP, cortical plate. Scale bar, 50 μm. ( b ) Quantification of the percentage of RFP + /GFP + cells in different regions of the developing cortex after electroporation shown in a . Data are shown as mean±s.e.m., t -test, ** P <0.01 and *** P <0.001, n =3 individual experiments. ( c ) Inhibition of Shh by Cyclopamine can partially rescue neurogenesis defects caused by Rcor2 downregulation during cortical development. Rcor2 was knocked down at the lateral ventricle in the brain by in-utero electroporation with RFP-shRcor2 plasmids at E13.5. Cerebral sections were collected at E14.5 and then treated with cyclopamine to inhibit Shh activity for 48 h. Scale bar, 50 μm. ( d ) Quantification of the percentage of RFP + cells in different regions of the developing neocortex after knockdown of Rcor2 or inhibition of Shh shown in c . Data are shown as mean±s.e.m., t -test, * P <0.05, n =3 individual experiments. ( e ) Representative images depicting neurosphere size is partially rescued in the in-vitro -cultured Rcor2 cko NPCs after treatment with Cyclopamine. Scale bar, 50 μm. ( f ) Histogram depicting cell numbers of in-vitro -cultured Rcor2 fl/fl and Rcor2 cko NPCs with or without Cyclopamine treatment for 48 h. Cells (5 × 10 5 ) are seeded initially. Data are shown as mean±s.e.m., t -test, ** P <0.01, n =3. ( g ) Confocal images of Tuj1 expression in the differentiated cells from in-vitro -cultured Rcor2 fl/fl and Rcor2 cko NPCs with or without Cyclopamine treatment. Tuj1 expressions are partially restored in Cyclopamine-treated Rcor2 cko cells. Scale bar, 20 μm. ( h ) Model of Rcor2 function in neurogenesis in the developing neocortex. Rcor2 safeguards cortical neurogenesis by recruiting LSD1 complex to the regulatory regions of Dlx2 and Shh genes, to inhibit the Shh pathway activation during development. The absence of Rcor2 leads to inhibition release of these genes and thus ectopic activation of Shh signalling in the developing neocortex, resulting in cortical neurogenesis defects.

Article Snippet: Primary antibodies used were as follows: Rcor2 (1:50, catalogue number NBP1-74099, Novus Biological); Nes (1:300, catalogue number Rat-401, DSHB); Pax6 (1:100, DSHB); Sox2 (1:500, catalogue number sc-17319, Santa Cruz); BrdU (1:500, catalogue number ab6326, Abcam); Ki67 (1:300, catalogue number ab9260, Millipore); Satb2 (1:500, catalogue number ab34735, Abcam); Olig2 (1:200, catalogue number ab109186, Abcam); Shh (1:100, catalogue number sc-33943, Santa Cruz); Ptch1 (1:100, catalogue number sc-6149, Santa Cruz); Dlx2 (1:500, catalogue number ab117546, Abcam); Nkx2.1 (1:300, catalogue number ab76013, Abcam); Tbr1 (1:500, catalogue number ab31940, Abcam); Dcx (1:500, catalogue number ab18723, Abcam); Tbr2 (1:500, catalogue number ab23345, Abcam); Flag M2 (1:1,000, catalogue number F1804, Sigma); Map2 (1:500, catalogue number ab32454, Abcam); and Tuj1 (1:1,000, catalogue number mms-435p, Convance).

Techniques: Knockdown, In Utero, Electroporation, Inhibition, Activity Assay, In Vitro, Cell Culture, Expressing, Activation Assay

Journal: Frontiers in Immunology

Article Title: Focal adhesion kinase plays an essential role in Th17 cell differentiation by stimulating NF-κB signaling

doi: 10.3389/fimmu.2025.1596802

Figure Lengend Snippet: FAK is highly expressed in and required for Th17 cells. (A) Naïve CD4 T cells were cultured under each subset differentiation conditions for 3 days. The transcript level of Fak was measured by RT-qPCR (left) and the protein level of FAK was measured by immunoblot analysis (right). (B, C) Naïve CD4 T cells from Fak fl/fl mice were introduced with a control empty vector (control) or a CRE recombinase-expressing vector (RV-Cre) to induce Fak deletion and cultured under Th17-polarizing conditions for 3 days (B) or various subset-polarizing conditions (C) for 3 days. (B) GFP+ cells were sorted. The transcript level of Fak was measured by RT-qPCR (left) and the protein level of FAK was measured by immunoblot analysis (right). (C) The expression of GFP, IFN-γ, IL-4, IL-17A, and FOXP3 was analyzed by flow cytometry (top). The statistical analysis was performed on pooled data from five independent experiments (bottom). Error bars represent the standard deviation. The significance of differences between groups was determined by one-way ANOVA (A) and Student t test (B, C) . ***P < 0.001; ****P < 0.0001, n.s., not significant.

Article Snippet: Th1: mouse recombinant IL-2 (1 ng/ml, eBioscience), mouse recombinant IL-12 p70 (3.5 ng/ml, eBioscience), and anti-mouse IL-4 (5 μg/ml); Th2: mouse recombinant IL-2 (1 ng/ml), mouse recombinant IL-4 (5 ng/ml, R&D systems), and anti-mouse IFNγ (5 μg/ml); Th17: mouse recombinant IL-6 (50 ng/ml, R&D systems), human recombinant TGFβ1 (1 ng/ml, R&D systems), mouse recombinant TNFα (1 ng/ml, eBioscience), mouse recombinant IL-1β (2 ng/ml, Gibco), anti-mouse IFNγ (5 μg/ml), and anti-mouse IL-4 (5 μg/ml); Tregs: mouse recombinant IL-2 (1 ng/ml), human recombinant TGFβ1 (5 ng/ml), anti-mouse IFNγ (10 μg/ml), and anti-mouse IL-4 (10 μg/ml).

Techniques: Cell Culture, Quantitative RT-PCR, Western Blot, Control, Plasmid Preparation, Expressing, Flow Cytometry, Standard Deviation

Journal: Frontiers in Immunology

Article Title: Focal adhesion kinase plays an essential role in Th17 cell differentiation by stimulating NF-κB signaling

doi: 10.3389/fimmu.2025.1596802

Figure Lengend Snippet: FAK affects Th17 cell differentiation program. (A, B) Naïve CD4 T cells from Fak fl/fl mice were cultured and sorted as Figure 1B . (A) IL-17A+ and FOXP3+ cells were measured by flow cytometry. (B) Transcript levels of Il17a , Rorc , Il23r , and Foxp3 were measured by RT-qPCR. (C, D) Naïve CD4 T cells were introduced with either the control vector (MSCV-LMP) or Fak shRNA vectors (#1, #2, and #3) and cultured under Th17-polarizing conditions for 3 days. (C) The transcript level of Fak was measured by RT-qPCR (left) and protein level of FAK was measured by immunoblot analysis (right). (D) IL-17A+ cells among the vector-transduced cells (GFP+) were measured by flow cytometry (left). GFP+ cells were sorted and the transcript level of Il17a was measured by RT-qPCR (right). All of RT-qPCR data were normalized to Gapdh . (E–G) Naïve CD4 T cells were transduced with control or RV-Cre and cultured under Th17-polarizing conditions for 3 days. GFP+ cells were sorted and subjected to RNA-seq analysis. (E) Scatter plot of RNA-seq data. (F) Gene ontology analysis of differentially expressed genes (DEGs) from control and RV-Cre-transduced Th17 cells. (G) Heatmap of immune/inflammatory response-related genes among the DEGs from control and RV-Cre-transduced Th17 cells. All of RT-qPCR data were normalized to Gapdh . Data in (A–D) are pooled from three independent experiments. Error bars represent the standard deviation. The significance of differences between groups was determined by Student t test. **P < 0.01; ***P < 0.001; ****P < 0.0001.

Article Snippet: Th1: mouse recombinant IL-2 (1 ng/ml, eBioscience), mouse recombinant IL-12 p70 (3.5 ng/ml, eBioscience), and anti-mouse IL-4 (5 μg/ml); Th2: mouse recombinant IL-2 (1 ng/ml), mouse recombinant IL-4 (5 ng/ml, R&D systems), and anti-mouse IFNγ (5 μg/ml); Th17: mouse recombinant IL-6 (50 ng/ml, R&D systems), human recombinant TGFβ1 (1 ng/ml, R&D systems), mouse recombinant TNFα (1 ng/ml, eBioscience), mouse recombinant IL-1β (2 ng/ml, Gibco), anti-mouse IFNγ (5 μg/ml), and anti-mouse IL-4 (5 μg/ml); Tregs: mouse recombinant IL-2 (1 ng/ml), human recombinant TGFβ1 (5 ng/ml), anti-mouse IFNγ (10 μg/ml), and anti-mouse IL-4 (10 μg/ml).

Techniques: Cell Differentiation, Cell Culture, Flow Cytometry, Quantitative RT-PCR, Control, Plasmid Preparation, shRNA, Western Blot, Transduction, RNA Sequencing, Standard Deviation

Journal: Frontiers in Immunology

Article Title: Focal adhesion kinase plays an essential role in Th17 cell differentiation by stimulating NF-κB signaling

doi: 10.3389/fimmu.2025.1596802

Figure Lengend Snippet: FAK deficiency ameliorates the severity of EAE. (A, B) Naïve CD4 T cells from WT and Fak fl/fl Rorc cre mice were cultured under polarizing conditions toward each different subset for 3 days. Transcript levels of Ifng for Th1 cells, Il4 for Th2 cells, Il17a for Th17 cells, and Foxp3 for Treg cells were measured by RT-qPCR (A) and the percentage of IL-17A+ cells under Th17-polarizing conditions was measured by flow cytometry (B) . (C) EAE was induced in control (WT, n = 10) and Fak fl/fl Rorc cre (n = 10) mice as described in the Materials and Methods section. The symptoms of EAE were monitored every day and clinical scores were evaluated after EAE induction. (D, E) Histopathological analysis of lumbar spinal cords from control and Fak fl/fl Rorc cre mice at the peak of the disease. (D) H&E stained sections of spinal cords. Arrows indicate the inflammatory foci. (E) Immunohistochemical staining of myelin basic protein (MBP). Arrows indicate the more preserved myelin in Fak fl/fl Rorc cre mice compared with control mice. (F) IL-17A+ and IFNγ+ cells (left) and FOXP3+ cells (right) among CNS-infiltrating CD4 T cells were measured by flow cytometry. (G–J) The percentage and absolute number of CNS-infiltrating mononuclear cells were measured. (G) CD4+ cells, (H) IL-17A+ cells, (I) IFNγ+ cells, and (J) FOXP3+ cells. (K) Transcript levels of Il17a , Rorc , Il23r , Ifng , and Foxp3 in CNS-infiltrating mononuclear cells were measured by RT-qPCR. Data were normalized to Gapdh . Data in (F–K) are pooled from ten independent experiments. Error bars represent the standard deviation. The significance of differences between groups was determined by Student t test. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001, n.s., not significant.

Article Snippet: Th1: mouse recombinant IL-2 (1 ng/ml, eBioscience), mouse recombinant IL-12 p70 (3.5 ng/ml, eBioscience), and anti-mouse IL-4 (5 μg/ml); Th2: mouse recombinant IL-2 (1 ng/ml), mouse recombinant IL-4 (5 ng/ml, R&D systems), and anti-mouse IFNγ (5 μg/ml); Th17: mouse recombinant IL-6 (50 ng/ml, R&D systems), human recombinant TGFβ1 (1 ng/ml, R&D systems), mouse recombinant TNFα (1 ng/ml, eBioscience), mouse recombinant IL-1β (2 ng/ml, Gibco), anti-mouse IFNγ (5 μg/ml), and anti-mouse IL-4 (5 μg/ml); Tregs: mouse recombinant IL-2 (1 ng/ml), human recombinant TGFβ1 (5 ng/ml), anti-mouse IFNγ (10 μg/ml), and anti-mouse IL-4 (10 μg/ml).

Techniques: Cell Culture, Quantitative RT-PCR, Flow Cytometry, Control, Staining, Immunohistochemical staining, Standard Deviation

Journal: Frontiers in Immunology

Article Title: Focal adhesion kinase plays an essential role in Th17 cell differentiation by stimulating NF-κB signaling

doi: 10.3389/fimmu.2025.1596802

Figure Lengend Snippet: FAK regulates the STAT3 signaling pathway in Th17 cells. (A) Naïve CD4 T cells were cultured under various differentiation conditions for the indicated time periods and the transcript levels of Fak , Il17a , Rorc , and Il17f were measured by RT-qPCR. (B) Naïve CD4 T cells were introduced with control vector or Rorc -expressing vector ( Rorc O/X) and cultured in Th17-polarizing conditions for 3 days. Transcript levels of Rorc , Il17a , and Fak were measured by RT-qPCR. (C) Naïve CD4 T cells were cultured under Th17-polarizing conditions with dose-dependent treatment of GSK805 for 3 days. Transcript levels of Il17a and Fak were measured by RT-qPCR. (D, E) Naïve CD4 T cells from Fak fl/fl mice were cultured as described in Figure 1B and GFP+ cells were sorted. (D) Each protein level was measured by immunoblot analysis (left) and the ratios of pSTAT3/STAT3 and pSTAT5/STAT5 were calculated by densitometry (right). (E) Transcript level of Il2 was measured by RT-qPCR (left) and the protein level of IL-2 from the supernatants was measured by ELISA (right). All of RT-qPCR data were normalized to Gapdh . Data in (A, B, D, E) were pooled from three independent experiments, and data in (C) from five. Error bars represent the standard deviation. The significance of differences between groups was determined by Student t test. **P < 0.01; ***P < 0.001; ****P < 0.0001, n.s., not significant.

Article Snippet: Th1: mouse recombinant IL-2 (1 ng/ml, eBioscience), mouse recombinant IL-12 p70 (3.5 ng/ml, eBioscience), and anti-mouse IL-4 (5 μg/ml); Th2: mouse recombinant IL-2 (1 ng/ml), mouse recombinant IL-4 (5 ng/ml, R&D systems), and anti-mouse IFNγ (5 μg/ml); Th17: mouse recombinant IL-6 (50 ng/ml, R&D systems), human recombinant TGFβ1 (1 ng/ml, R&D systems), mouse recombinant TNFα (1 ng/ml, eBioscience), mouse recombinant IL-1β (2 ng/ml, Gibco), anti-mouse IFNγ (5 μg/ml), and anti-mouse IL-4 (5 μg/ml); Tregs: mouse recombinant IL-2 (1 ng/ml), human recombinant TGFβ1 (5 ng/ml), anti-mouse IFNγ (10 μg/ml), and anti-mouse IL-4 (10 μg/ml).

Techniques: Cell Culture, Quantitative RT-PCR, Control, Plasmid Preparation, Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Standard Deviation

Journal: Frontiers in Immunology

Article Title: Focal adhesion kinase plays an essential role in Th17 cell differentiation by stimulating NF-κB signaling

doi: 10.3389/fimmu.2025.1596802

Figure Lengend Snippet: FAK regulates Th17 cell differentiation through the NF-κB pathway. (A) Naïve CD4 T cells from Fak fl/fl mice were transduced with control vector or RV-Cre and cultured under Th17-polarizing conditions for 3 days. GFP+ cells were sorted and rested in normal media for 2 days and serum-free medium for an additional 8 hours. The cells were restimulated with anti-CD3/CD28 antibodies for the indicated time periods, and nuclear/cytoplasmic extracts were prepared. Each protein level was measured by immunoblot analysis (right). The ratios of IκB/β-Actin, pIκB/β-Actin, and nuclear RelA/cytoplasmic RelA were calculated by densitometry (right). (B, C) Naïve CD4 T cells from Fak fl/fl mice were transduced with RV-Cre and cultured under Th17-polarizing conditions for 3 days (B) and 16 hours (C) and GFP+ cells were sorted. (B) Transcript level of Socs3 was measured by RT-qPCR. (C) Relative RelA binding to each indicated locus was measured through ChIP assay. Nuclear extracts from cultured cells were reacted with an anti-RelA antibody, and precipitated DNA fragments were measured by qPCR. Isotype-matching IgG was used as a negative control. (D–F) Il17a promoter activity was measured through luciferase assay. (D) EL4 cells were transfected with pGL3- Il17a promoter vector and control or Fak siRNA, and the cells were rested for 20 hours. After transfection, the cells were divided into non-stimulated or stimulated groups, with the stimulated groups received 4 hour stimulation with PMA/ionomycin. (E) EL4 cells were transfected with the pGL3- Il17a promoter vector and rested for 20 hours with or without PDTC treatment (1 μM). (F) EL4 cells were transfected as described in (D) and rested for 20 hours with 1 μM PDTC treatment. (G–I) Naïve CD4 T cells from Rela fl/fl mice were introduced with a control empty vector (WT) or a Cre recombinase expressing vector (p65 KO) to induce Rela deletion and cultured under Th17-polarizing conditions for 3 days. (G) IL-17A+ and FOXP3+ cells were measured by flow cytometry. (H) GFP+ cells were sorted and transcript level of Rela , Il17a , Rorc , and Il23r were measured by RT-qPCR. (I) Naïve CD4 T cells from Rela fl/fl mice were cultured as described in (G) and additionally treated with vehicle (control) or FAK inhibitor (PND1186, 1 μM). IL-17A+ and FOXP3+ cells were measured by flow cytometry. RT-qPCR data in (B, H) were normalized to Gapdh . Data in (A–I) are pooled from three independent experiments. Error bars represent the standard deviation. The significance of differences between groups was determined by Student t test. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Article Snippet: Th1: mouse recombinant IL-2 (1 ng/ml, eBioscience), mouse recombinant IL-12 p70 (3.5 ng/ml, eBioscience), and anti-mouse IL-4 (5 μg/ml); Th2: mouse recombinant IL-2 (1 ng/ml), mouse recombinant IL-4 (5 ng/ml, R&D systems), and anti-mouse IFNγ (5 μg/ml); Th17: mouse recombinant IL-6 (50 ng/ml, R&D systems), human recombinant TGFβ1 (1 ng/ml, R&D systems), mouse recombinant TNFα (1 ng/ml, eBioscience), mouse recombinant IL-1β (2 ng/ml, Gibco), anti-mouse IFNγ (5 μg/ml), and anti-mouse IL-4 (5 μg/ml); Tregs: mouse recombinant IL-2 (1 ng/ml), human recombinant TGFβ1 (5 ng/ml), anti-mouse IFNγ (10 μg/ml), and anti-mouse IL-4 (10 μg/ml).

Techniques: Cell Differentiation, Transduction, Control, Plasmid Preparation, Cell Culture, Western Blot, Quantitative RT-PCR, Binding Assay, Negative Control, Activity Assay, Luciferase, Transfection, Expressing, Flow Cytometry, Standard Deviation

Journal: Frontiers in Immunology

Article Title: Focal adhesion kinase plays an essential role in Th17 cell differentiation by stimulating NF-κB signaling

doi: 10.3389/fimmu.2025.1596802

Figure Lengend Snippet: A FAK inhibitor blocks differentiation of Th17 cells in vitro. (A–E) Naïve CD4 T cells were cultured under Th17- or Treg-polarizing conditions with dose-dependent treatment of PND1186 for 3 days. IL-17A+ and FOXP3+ cells were measured by flow cytometry (A) and transcript levels of Il17a and Foxp3 were measured by RT-qPCR (C) in Th17 cells. FOXP3+ cells were measured by flow cytometry (B) and transcript level of Foxp3 was measured by RT-qPCR (D) in Treg cells. (E–G) Naïve CD4 T cells were cultured under Th17-polarizing conditions with vehicle (control) or PND1186 (1 μM) treatment for 3 days (E, G) and the indicated time periods (F) . (E) pSTAT3 and pSTAT5 levels were measured by flow cytometry. (F) Nuclear or cytoplasmic extracts were prepared from cultured cells, and each protein level was measured by immunoblot analysis (right). The ratios of IκB/β-Actin, pIκB/β-Actin, and nuclear RelA/cytoplasmic RelA were calculated by densitometry (right). (G) Relative RelA binding to each indicated locus was measured through ChIP assay. Nuclear extracts from cultured cells were incubated with an anti-RelA antibody and the precipitated DNA fragments were measured by qPCR. An isotype-matching IgG was used as a negative control. RT-qPCR data in (C, D) were normalized to Gapdh . Data in (A–G) are pooled from three independent experiments. Error bars represent the standard deviation. The significance of differences between groups was determined by Student t test. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Article Snippet: Th1: mouse recombinant IL-2 (1 ng/ml, eBioscience), mouse recombinant IL-12 p70 (3.5 ng/ml, eBioscience), and anti-mouse IL-4 (5 μg/ml); Th2: mouse recombinant IL-2 (1 ng/ml), mouse recombinant IL-4 (5 ng/ml, R&D systems), and anti-mouse IFNγ (5 μg/ml); Th17: mouse recombinant IL-6 (50 ng/ml, R&D systems), human recombinant TGFβ1 (1 ng/ml, R&D systems), mouse recombinant TNFα (1 ng/ml, eBioscience), mouse recombinant IL-1β (2 ng/ml, Gibco), anti-mouse IFNγ (5 μg/ml), and anti-mouse IL-4 (5 μg/ml); Tregs: mouse recombinant IL-2 (1 ng/ml), human recombinant TGFβ1 (5 ng/ml), anti-mouse IFNγ (10 μg/ml), and anti-mouse IL-4 (10 μg/ml).

Techniques: In Vitro, Cell Culture, Flow Cytometry, Quantitative RT-PCR, Control, Western Blot, Binding Assay, Incubation, Negative Control, Standard Deviation